Israel Oceanographic & Limnologic Research - Israel Marine Data Center (ISRAMAR) Israel Oceanographic & Limnologic Research (IOLR) - Home Page Israel Marine Data Center (ISRAMAR) - Home Page

Taxon description

Scientific Name: Plotosus lineatus

Scientific Classification
Kingdom   Animalia
Phylum     Chordata
Class         Actinopterygii
Order       Siluriformes
Family      Plotosidae
Genus       Plotosus
Specie       lineatus
 
   
 










     
   

Geographical and temporal distribution

   

Barcoding

 
GGCACAGCCCTAAGCCTACTAATTCGAGCAGAACTAGCTCAGCCAGGCTCATTCCTAGGCGATGACCAAATTTATAATGTTATCGTCACTGCGCATGCCTTCGTAATAATTTTCTTTATAGTAATGCCAGTTATGATCGGGGGATTTGGAAACTGATTAGTCCCACTAATAATTGGGGCCCCAGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGATTACTCCCCCCCTCATTTTTACTCTTACTAGCCTCCTCGGGGGTTGAGGCTGGAGCCGGAACAGGGTGAACTGTTTACCCACCTCTCGCCGGTAATATCGCACACGCAGGTGCTTCTGTCGATTTAACTATCTTCTCCTTACACCTCGCCGGAGTATCATCTATTCTAGGCGCTATTAACTTCATCACAACTATCATCAATATAAAACCCCCAGCCATCTCACAGTACCAAACACCCCTGTTCGTTTGATCTGTATTAATTACAGCCGTCCTCCTCCTTTTATCCCTGCCGGTACTAGCCGCTGGCATTACAATACTATTAACAGACCGAAACTTAAATACAACATTCTTCGACCCAGCAGGCGGAGGCGACCCCATCCTCT

Primers used:
FISH-1
Marker gene:
COI-5P
BOLD sample ID:
BIM M21
 
 


Forward primer sequence:  
TCAACCAACCACAAAGACATTGGCAC


Revesre primer sequence:  
TAGACTTCTGGGTGGCCAAAGAATCA

   

© Israel Oceanographic & Limnological Research. All Rights Reserved      Terms of Use     About Us

© כל הזכויות שמורות. אין לעשות שימוש בנתונים ללא אישור בכתב מחיא"ל