Israel Oceanographic & Limnologic Research - Israel Marine Data Center (ISRAMAR) Israel Oceanographic & Limnologic Research (IOLR) - Home Page Israel Marine Data Center (ISRAMAR) - Home Page

Taxon description

Scientific Name: Murex forskoehlii

Scientific Classification
Kingdom   Animalia
Phylum     Mollusca
Class         Gastropoda
Order       Neogastropoda
Family      Muricidae
Genus       Murex
Specie       forskoehlii
 
   
 










     
   

Geographical and temporal distribution

   

Barcoding

 
ATCAAAAAATGCTGTATTAAAATTTCGATCAGTTAACAACATAGTAATAGCACCAGCTAAAACAGGTAGAGATAGAAGCAATAAAATAGCTGTAATTTTAACAGACCAAACAAATAAAGGAACGCGCTCAAACTGCATTCCTCGTCATCGCATGTTAATAATAGTTGTAATAAAATTTACAGCACCGAGAATAGAAGAAGCACCAGCTAAATGTAAAGAGAAAATAGCTAGATCTACAGACCCACCAGCATGTGCTAAATTTCCAGCAAGAGGGGGATATACTGTCCATCCAGTCCCAACCCCACTTTCTACCGCAGCAGAAGATAACAACAGAAGAAGTGCCGGAGGTAATAACCAAAATCTTATATTATTTAATCGAGGGAAAGCCATATCTGGGGCACCAAGTATTAGAGGTACCAGTCAATTACCAAATCCTCCAATTATTATTGGCATAACTAAAAAGAAAATTATAACAAAAGCATGTGCAGTTACAATAACATTATATAATTGATCGTCCCCCAGCAAAGCCCCAGGTTGCCCTAATTCGGCCCGAATAAGAAGACTTAAAGCAGTAC


Marker gene:
COI-5P
BOLD sample ID:
BIM E43
 
 


 



 


   

© Israel Oceanographic & Limnological Research. All Rights Reserved      Terms of Use     About Us

© כל הזכויות שמורות. אין לעשות שימוש בנתונים ללא אישור בכתב מחיא"ל