Israel Oceanographic & Limnologic Research - Israel Marine Data Center (ISRAMAR) Israel Oceanographic & Limnologic Research (IOLR) - Home Page Israel Marine Data Center (ISRAMAR) - Home Page

Taxon description

Scientific Name: Echelus myrus

Scientific Classification
Kingdom   Animalia
Phylum     Chordata
Class         Actinopterygii
Order       Anguilliformes
Family      Ophichthidae
Genus       Echelus
Specie       myrus
 
   
 










     
   

Geographical and temporal distribution

   

Barcoding

 
AATAGTAGGCACCGCCCTGAGCCTTCTAATTCGAGCTGAATTAAGTCAACCCGGAGCTCTCCTGGGAGACGACCAAATTTATAATGTTATCGTCACGGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCTGTAATAATTGGGGGTTTCGGCAATTGACTAGTCCCCCTAATAATTGGAGCCCCTGACATGGCATTTCCACGAATGAATAACATAAGCTTCTGACTCCTTCCCCCATCATTTCTGCTCTTATTAGCCTCTTCTGGAGTTGAAGCAGGGGCAGGTACAGGATGAACTGTCTACCCCCCTCTAGCTGGAAATCTTGCTCACGCGGGAGCCTCCGTTGATCTAACAATCTTTTCCCTACATCTTGCCGGAGTCTCATCAATCCTGGGAGCAATTAACTTTATTACCACAATCATTAACATAAAACCCCCAGCAATTACACAATACCAAACACCCCTATTCGTTTGATCTGTTCTAGTAACAGCTGTACTCCTGCTCCTCTCCCTGCCAGTTCTCGCCGCAGGGATTACAATACTACTCACAGACCGAAACCTAAACACAACATTCTTTGACCCAG

Primers used:
FISH-1
Marker gene:
COI-5P
BOLD sample ID:
BIM E143
 
 


Forward primer sequence:  
TCAACCAACCACAAAGACATTGGCAC


Revesre primer sequence:  
TAGACTTCTGGGTGGCCAAAGAATCA

   

© Israel Oceanographic & Limnological Research. All Rights Reserved      Terms of Use     About Us

© כל הזכויות שמורות. אין לעשות שימוש בנתונים ללא אישור בכתב מחיא"ל